תמונות/קולות

מתצפת/ת

theachesney

תאריך

אפריל 27, 2022 12:48 PM PDT
Porodaedalea - Photo (c) Kari Pihlaviita,  זכויות יוצרים חלקיות (CC BY-NC)
הזיהוי של pogon: סוג Porodaedalea, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 06 מאי, 2022
תומך

תמונות/קולות

מתצפת/ת

schwee

תאריך

ינואר 13, 2022 02:14 PM PST
Lactarius alnicola - Photo (c) Christian Schwarz,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Christian Schwarz
הזיהוי של pogon: Lactarius alnicola, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 08 מרץ, 2022
תומך

תמונות/קולות

מתצפת/ת

okbirdman

תאריך

מרץ 7, 2022 03:18 PM PST
Leratiomyces percevalii - Photo (c) Damon Tighe,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Damon Tighe
הזיהוי של pogon: Leratiomyces percevalii, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 08 מרץ, 2022
תומך

תמונות/קולות

מתצפת/ת

halula

תאריך

ינואר 22, 2022 10:34 AM PST

תיאור

Quite dry . Fibrous stipe. Free gills without annulus.

קטיפנית - Photo (c) David Greenberger,  זכויות יוצרים חלקיות (CC BY-NC-ND), uploaded by David Greenberger
הזיהוי של pogon: קטיפנית (סוג Pluteus)
הוסף בתאריך 22 ינואר, 2022
תומך

תמונות/קולות

מתצפת/ת

halula

תאריך

ינואר 22, 2022 12:10 PM PST
Hypholoma fasciculare - Photo (c) Liam O'Brien,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Liam O'Brien
הזיהוי של pogon: Hypholoma fasciculare, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 22 ינואר, 2022
תומך

תמונות/קולות

מה

בהוקית (סוג Ganoderma)

מתצפת/ת

halula

תאריך

אוגוסט 23, 2020 10:39 AM PDT

תיאור

Fruiting on liquid amber tree

Ganoderma applanatum - Photo (c) Stephany Gale, כל הזכויות שמורות, uploaded by Stephany Gale
הזיהוי של pogon: קומפלקס Ganoderma applanatum, שייך ל בהוקית (סוג Ganoderma)
הוסף בתאריך 22 ינואר, 2022
מוביל

תמונות/קולות

מתצפת/ת

halula

תאריך

ינואר 15, 2022 01:17 PM PST
Sarcoscypha occidentalis - Photo (c) אנונימי,  זכויות יוצרים חלקיות (CC BY-SA)
הזיהוי של pogon: Sarcoscypha occidentalis, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 22 ינואר, 2022
מוביל

תמונות/קולות

מתצפת/ת

jsurdzial

תאריך

אוקטובר 12, 2018 01:26 PM PDT
Phaeoclavulina myceliosa - Photo (c) Robin Gwen Agarwal,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Robin Gwen Agarwal
הזיהוי של pogon: Phaeoclavulina myceliosa, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 21 ינואר, 2022
תומך
נוסף בגלל שינוי טקסונומי

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 03:39 PM UTC
Gomphidius subroseus - Photo (c) Christian Schwarz,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Christian Schwarz
הזיהוי של pogon: Gomphidius subroseus, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 13 דצמבר, 2021
שיפור

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 02:57 PM UTC
Xerocomellus - Photo (c) Christian Schwarz,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Christian Schwarz
הזיהוי של pogon: סוג Xerocomellus, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 13 דצמבר, 2021
שיפור

תמונות/קולות

מתצפת/ת

emilyrose346

תאריך

דצמבר 6, 2021 03:48 PM PST
Leocarpus - Photo (c) Joseph O'Brien,  זכויות יוצרים חלקיות (CC BY)
הזיהוי של pogon: סוג Leocarpus, שייך ל פיטריריות (מחלקה Myxomycetes)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 03:00 PM UTC
Rhodofomes cajanderi - Photo (c) Danny Newman,  זכויות יוצרים חלקיות (CC BY-NC-SA), uploaded by Danny Newman
הזיהוי של pogon: Rhodofomes cajanderi, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

ruby_nunncurtis

תאריך

דצמבר 5, 2021 10:54 AM PST

תיאור

Rust on common sowthistle (sonchus oleraceus) 3d picture is of paraphyses and last picture is of urediniospores both at x800 magnification. Last photo is x200 magnification

Miyagia pseudosphaeria - Photo (c) Mike Lusk,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Mike Lusk
הזיהוי של pogon: Miyagia pseudosphaeria, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

emilyrose346

תאריך

דצמבר 6, 2021 03:52 PM PST
Suillus - Photo (c) Alan Rockefeller,  זכויות יוצרים חלקיות (CC BY), uploaded by Alan Rockefeller
הזיהוי של pogon: סוג Suillus, שייך ל פטרית עץ (מחלקה Agaricomycetes)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

emilyrose346

תאריך

דצמבר 6, 2021 09:40 PM PST
Pilobolus - Photo (c) Jerry Cooper,  זכויות יוצרים חלקיות (CC BY), uploaded by Jerry Cooper
הזיהוי של pogon: סוג Pilobolus, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 13 דצמבר, 2021
שיפור

תמונות/קולות

מתצפת/ת

wongatrappin

תאריך

דצמבר 12, 2021 03:06 PM PST

תיאור

Viscid caps, growing abundantly from woodchip bed.

Brown spores visible on partial veil ring

Pholiota velaglutinosa - Photo (c) Damon Tighe,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Damon Tighe
הזיהוי של pogon: Pholiota velaglutinosa, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

johnplischke

תאריך

ספטמבר 22, 2012
Trichothecium roseum - Photo (c) John Plischke,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by John Plischke
הזיהוי של pogon: Trichothecium roseum, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 13 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 08:05 AM UTC
Hypholoma capnoides - Photo (c) noah_siegel,  זכויות יוצרים חלקיות (CC BY-NC-SA), uploaded by noah_siegel
הזיהוי של pogon: Hypholoma capnoides, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 05 דצמבר, 2021
מוביל

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 02:39 PM UTC
Armillaria - Photo (c) AnneTanne,  זכויות יוצרים חלקיות (CC BY-NC)
הזיהוי של pogon: סוג Armillaria, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 05 דצמבר, 2021
שיפור

תמונות/קולות

מתצפת/ת

ruby_nunncurtis

תאריך

דצמבר 4, 2021 09:12 AM PST

תיאור

Observation of white fungus covering oak loving bolete

Hypomyces chrysospermus - Photo (c) J. Maughn,  זכויות יוצרים חלקיות (CC BY-NC)
הזיהוי של pogon: Hypomyces chrysospermus, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 05 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

ruby_nunncurtis

תאריך

דצמבר 4, 2021 10:11 AM PST

תיאור

On dung.

Phycomyces - Photo (c) brngckn, כל הזכויות שמורות, uploaded by brngckn
הזיהוי של pogon: סוג Phycomyces, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 05 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 03:47 PM UTC
Amanitaceae - Photo (c) illypinot, כל הזכויות שמורות
הזיהוי של pogon: משפחה Amanitaceae, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 04 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 02:52 PM UTC
הזיהוי של pogon: Subsection Gemmatae, שייך ל אמנית (סוג Amanita)
הוסף בתאריך 04 דצמבר, 2021
מוביל

תמונות/קולות

מתצפת/ת

grier

תאריך

דצמבר 3, 2021 02:55 PM UTC
Lepiota rubrotinctoides - Photo (c) Trent Pearce, כל הזכויות שמורות, uploaded by Trent Pearce
הזיהוי של pogon: Lepiota rubrotinctoides, שייך ל מיטריינית (סוג Lepiota)
הוסף בתאריך 04 דצמבר, 2021
שיפור

תמונות/קולות

מתצפת/ת

mackenzieobrien2

תאריך

נובמבר 22, 2021 04:23 PM PST

תיאור

Kingdom: Fungi
Division: Basidiomycota
Class: Agaricomycetes
Order: Agaricales
Family: Hydnangiaceae
Genus: Laccaria

Laccaria amethysteo-occidentalis - Photo (c) Damon Tighe,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Damon Tighe
הזיהוי של pogon: Laccaria amethysteo-occidentalis, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 04 דצמבר, 2021
מוביל

תמונות/קולות

מתצפת/ת

damontighe

תאריך

ינואר 11, 2021 10:53 AM PST
Volutella ciliata - Photo (c) John Plischke,  זכויות יוצרים חלקיות (CC BY-NC-SA), uploaded by John Plischke
הזיהוי של pogon: Volutella ciliata, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 04 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

yaktilhinilhmono

תאריך

דצמבר 1, 2021 01:59 AM UTC

תיאור

Unknown, would love to work towards an identification. Spores are approximately 5x2 microns. No asci present.

Volutella ciliata - Photo (c) John Plischke,  זכויות יוצרים חלקיות (CC BY-NC-SA), uploaded by John Plischke
הזיהוי של pogon: Volutella ciliata, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 04 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

melanierf

תאריך

נובמבר 21, 2021 11:39 AM PST

תיאור

Gills decurrent, strong cedar scent!

Cuphophyllus russocoriaceus - Photo (c) Davide Puddu,  זכויות יוצרים חלקיות (CC BY-NC), uploaded by Davide Puddu
הזיהוי של pogon: Cuphophyllus russocoriaceus, שייך ל פקועיים (סדרה Agaricales)
הוסף בתאריך 04 דצמבר, 2021
תומך

תמונות/קולות

מתצפת/ת

kayleechristensen

תאריך

נובמבר 8, 2021 02:24 PM UTC

תיאור

Cultured from a white mold found on the soil of a houseplant. Identified using DNA sequencing.

DNA Sequence:
TCTCGCGCCGGGTTGCTCCCCTGGGGGGCTCCCGGGACTACGCGTCCGCCGGAGACCACAAACTCTTGATTTTGCGAAAGCAGTATTATTCTGAGTGGCCGAAAGGCAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTCGTCTTCATTGACGAGATCGGTGTTGGGACCCGGCGAGCGGGGACTCACGTCCCCTGCCGGTCCCGAAATTCAGTGGCGGCCCGTTGCGGCGACCTCTGCGTAGTAACTTAACCTCGCACTGGGACAGCAGCGCGGCCACGCCGTAAAACCCCCGACTTTTTTAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAA

הזיהוי של pogon: Simplicillium lanosiniveum [inactive], שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 03 דצמבר, 2021
מוביל
(טקסון לא פעיל)

תמונות/קולות

מתצפת/ת

melanierf

תאריך

נובמבר 20, 2021 03:32 PM PST
Cladonia - Photo (c) Ilja Klutman,  זכויות יוצרים חלקיות (CC BY-NC-SA)
הזיהוי של pogon: סוג Cladonia, שייך ל פטריות (ממלכה Fungi)
הוסף בתאריך 03 דצמבר, 2021
תומך

סטטיסטיקות

  • 2246