Psilocybe caeruleorhiza nom. prov.
Description deadline is January 15th 2024.
Found in the same original Ohio location found by Kyle Canan.
The first 4 photos after the cover are my iPhone photos.
Low Tek fruiting method using naturalized woodchip spawn. Fruited in a tote left outside through late November. The culture was collected from a clone from observation https://www.inaturalist.org/observations/96176456
Near water on decaying mossy wood among tall grass. Visible blue staining on caps and stems
Psilocybe_sp_ITS (502 bp)
CATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGCCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTSCCCCGCGCAGAGCCGTCTATTGGTGTGATAATT
This was found in the Malaysian rainforest on a pile on elephant dung. I have found many others on other dung piles (Tapir as well) around the rainforest. There was what I think is deconia coprophila on the same pile as this mushroom. Please help me identify this.
One growing out of a hole, the other is not. The one growing out of the hole had a pseudorhiza, the other did not.
First recorded INaturalist observation in Oregon at Crater Lake National Park!
Alan this is all I’ve seen this season. It’s going to be scorching hot starting tomorrow. Let me know if I can help with anything. Cheers, Tia
Psilocybe magnispora
E. Horak, Guzmán & Desjardin (145914)
On Elephant dung
Psilocybe aff. makarora
Stem and cap fluoresce yellow under 365nm UV light
Growing near a stream in a spruce and pine forest. Fruitbodies were found in the grass next to the stream and on rotting wood nearby.
Spores ~ 12-14 x 6-8um
All microscopy at 1000x in KOH with scale bar showing 1um per tic
Isotype collection.
Found on a soil bank. Seen at XAL.
Stained with Phloxine.
'makarorae aff' aka 'jelly subs' fruiting in someones garden.
Sneaky sillokis...too close to heimii but so far. Phaeocollybia sp due to spore print bright orange.
Locals note that this phenotype opens more than many other collections of weraroa, suggesting a phenotype between weraroa and 'subsecotioides'.
Fruiting in alder mulch and debris- beneath Douglas fir and Alnus rubra.
Some older specimens staining blue-green at stipe base. Hundreds of fruit bodies within a ten foot radius.
Temp: 49-clear.
Psilocybe Cyanofibrillosa growing from woodchips in an elementary school playground.
Ganymede collection.
Spores are 9.25 – 10.5 (10.75) x 4.5 – 5.5. (Alan’s measurements)
Or (8.83) 9.80-10.3-10.64 (12.17) x (4.55) 5.02-5.2-5.53 (5.89) (Jan’s measurements).
DNA sequence shows it’s close to P. pelliculosa.
Collected November 24, 1966 by T. Hongo. Collection T. Hongo 3385.
Found in grass at the edge of a bamboo forest.
In wood chip landscaping. Taste strongly farinaceous, with no hint of radish or other flavors.
Stains super blue (see 3rd picture).
I can't really see the "flying saucer" pattern on the bigger ones, but it could have been deformed by the environment.
15cm tall, big wavy edged caps, blueing, singular or with stems fused at the base. In wood chip and soil.
https://inaturalist.nz/observations/87154556 (seq) April 23rd 2021
https://inaturalist.nz/observations/167069008 June 11th
https://inaturalist.nz/observations/168270398 June 10th
https://inaturalist.nz/observations/166561227 June 10th
https://inaturalist.nz/observations/158512396 April 23rd 2023
Growing in aged local woodchip bed. Small groups spread out ove at least a 2500ft2 area
Found during cyclone so was hard to take photos, needs sequencing but suspect something close to Psilocybe baeocystis.
spore purple black, in groups, on cow dung
Spores:
measuring 7.78 – 10.15 × 5.44 – 6.69 µm
Q = 1.26 – 1.64 ; N = 30
Me = 8.57 × 6.16 µm ; Qe = 1.38
9.00 × 6.35
8.45 × 6.13
8.91 × 6.31
8.71 × 6.50
8.31 × 5.71
9.11 × 6.62
9.01 × 6.60
8.71 × 6.17
8.11 × 6.08
8.25 × 6.12
10.15 × 6.18
8.82 × 6.61
8.78 × 6.05
7.89 × 5.52
8.40 × 6.48
8.20 × 6.05
8.36 × 6.25
8.09 × 5.68
8.43 × 6.03
8.16 × 6.23
8.50 × 6.30
8.61 × 6.35
8.41 × 6.48
8.24 × 5.72
8.63 × 6.28
8.57 × 6.34
8.97 × 6.69
8.56 × 5.92
8.20 × 5.44
7.78 × 6.19
Auweia collection.
[admin – Sat Aug 14 02:05:14 +0000 2010]: Changed location name from ‘Richmond, CA, USA’ to ‘Richmond, California, USA’
—
Image #4: Microscopy composite by Workman
—
Originally posted to Mushroom Observer on Feb. 19, 2009.
James R. collection.
—
Additional notes for sequences (bases on the right):
ITS:
—
Originally posted to Mushroom Observer on Mar. 9, 2022.
Found by my daughter. No blue bruising notice immediately, however upon zooming in on photos you can see some slight blue bruising at the stem Apex and on some of the Gil margins. Later as the mushroom dried, more intense bluing present in the gills at the stem connection and at the stem Apex. Found in a woodpile that appeared to be bulldozzed. Identification confirmed by Kenneth barbagallo