תמונות/קולות

מתצפת/ת

johnplischke

תאריך

אוגוסט 8, 2022 10:30 AM EDT

תמונות/קולות

מתצפת/ת

toutterrain

תאריך

אפריל 2013

מקום

Uganda (Google, OSM)

תמונות/קולות

מתצפת/ת

toutterrain

תאריך

מרץ 2013

מקום

Uganda (Google, OSM)

תמונות/קולות

מתצפת/ת

dandkforever

תאריך

יוני 29, 2022 05:19 PM EDT

תמונות/קולות

מתצפת/ת

vishwanathgowda

תאריך

יוני 2022

מקום

Karnataka, IN (Google, OSM)

תיאור

Found this on lower branch of wild tree. Night macro walk.

תמונות/קולות

מתצפת/ת

ana_kaahanui

תאריך

אפריל 30, 2022 12:35 PM EDT

תמונות/קולות

מתצפת/ת

bugzilla

תאריך

אוגוסט 28, 2021 07:51 AM EDT

תיאור

One of dozens of webs glistening in the morning dew.

תמונות/קולות

מתצפת/ת

snowmanstudios

תאריך

פברואר 15, 2022 09:27 PM UTC

תיאור

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

תמונות/קולות

מתצפת/ת

snowmanstudios

תאריך

פברואר 15, 2022 08:27 PM UTC

תיאור

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

תמונות/קולות

מתצפת/ת

anoopnair747

תאריך

מרץ 2021

מקום

Kerala, IN (Google, OSM)

תיאור

Rescued this beautiful creature from a owl and released in a suitable habitat

תמונות/קולות

מה

אורנגאוטן בורנאי (Pongo pygmaeus)

מתצפת/ת

michal243

תאריך

אפריל 2013

תמונות/קולות

מתצפת/ת

aravindmanoj

תאריך

ינואר 22, 2022

מקום

Dindigul (Google, OSM)

תמונות/קולות

מה

אורנגאוטן בורנאי (Pongo pygmaeus)

מתצפת/ת

michal243

תאריך

ספטמבר 2012

תמונות/קולות

מתצפת/ת

mattyfelp

תאריך

ינואר 6, 2022 09:58 PM EST

תמונות/קולות

מתצפת/ת

murugeshgeo

תאריך

אוגוסט 2021

מקום

Tamil Nadu, IN (Google, OSM)

תמונות/קולות

מה

אורנגאוטן בורנאי (Pongo pygmaeus)

מתצפת/ת

budak

תאריך

ספטמבר 2009

תמונות/קולות

מתצפת/ת

melagiris_wildlife_kans

תאריך

מאי 28, 2011 04:57 PM IST

תיאור

Observer: Sanjeev Kumar

תמונות/קולות

מתצפת/ת

valehu

תאריך

מאי 2021

מקום

Virginia, US (Google, OSM)

תמונות/קולות

מה

קייצת (סוג Erigeron)

מתצפת/ת

rundvm1

תאריך

אפריל 30, 2021 11:08 AM EDT

תמונות/קולות

מתצפת/ת

carrieseltzer

תאריך

פברואר 21, 2021 01:40 PM EST

תמונות/קולות

מה

אורנגאוטן בורנאי צפון-מזרחי (Pongo pygmaeus ssp. morio)

מתצפת/ת

alphaj16

תאריך

אוגוסט 2018

תמונות/קולות

מתצפת/ת

maryeford

תאריך

אוקטובר 2, 2014 02:15 PM EDT

תמונות/קולות

מתצפת/ת

maryeford

תאריך

אוקטובר 12, 2015 03:24 PM EDT

תמונות/קולות

מתצפת/ת

danielraju

תאריך

מרץ 15, 2017

תמונות/קולות

מתצפת/ת

ron1th

תאריך

יוני 25, 2020 08:30 AM IST

תיאור

Found a pair of Grey Slender Loris hiding in the thick canopy of a tree, got decent views

תמונות/קולות

מה

אורנגאוטן בורנאי (Pongo pygmaeus)

מתצפת/ת

gery-dupas

תאריך

נובמבר 2015

תמונות/קולות

מתצפת/ת

carrieseltzer

תאריך

מאי 2020

מקום

United States (Google, OSM)

תיאור

Well, this is one of the stranger wildlife interactions I’ve had in my yard. I’m sitting out here working with my laptop and a bag of M&Ms and this butterfly flies towards me and goes straight for the bag. I stare in disbelief as it climbs in, fumble for my phone, and snap a few shots before it climbs out and flies away.

תמונות/קולות

מה

דבורת עץ סגולה (Xylocopa violacea)

מתצפת/ת

snek_with_arms

תאריך

אוגוסט 19, 2016 02:22 PM CEST

תמונות/קולות

מתצפת/ת

graytreefrog

תאריך

אפריל 2020

מקום

Virginia, US (Google, OSM)

תיאור

First record of this species in Arlington County since 1977. Adult female found under a log in an upland area dominated by mountain laurel, similar to the habitat I’ve found this species in elsewhere in northern Virginia. This was in a park that has been extensively surveyed, yet there aren’t even any historical records of this species from this park. Absolutely amazing to find this species somewhere it has gone undetected for all this time.

תמונות/קולות

מה

אייל פרדי לבן-זנב (Odocoileus virginianus)

מתצפת/ת

jamesdunbar

תאריך

מאי 15, 2019 09:23 AM UTC

תמונות/קולות

מה

אורנגאוטן בורנאי מרכזי (Pongo pygmaeus ssp. wurmbii)

מתצפת/ת

cccrll

תאריך

יולי 2014

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ספטמבר 19, 2019 08:31 AM EDT

תמונות/קולות

מה

סנאי קרקע קליפורני (Otospermophilus beecheyi)

מתצפת/ת

jamesspitznas

תאריך

אוגוסט 9, 2010 08:46 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

אוגוסט 9, 2010 05:45 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ינואר 28, 2011 02:51 PM EST

תמונות/קולות

מה

חופית להקנית (Calidris canutus)

מתצפת/ת

jamesspitznas

תאריך

ינואר 28, 2011 03:57 PM EST

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ספטמבר 10, 2010 08:13 AM EDT

תיאור

Vesper Sparrow - Pooecetes gramineus

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ינואר 1, 2020 10:22 AM EST

תיאור

Long-tailed Duck (male, non-breeding) - Clangula hyemalis

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ינואר 1, 2020 12:12 PM EST

תיאור

American Wigeon Duck - Anas americana

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ספטמבר 29, 2019 07:52 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

נובמבר 3, 2019 11:39 AM EST

תמונות/קולות

מתצפת/ת

acmicrobiology

תאריך

דצמבר 3, 2019 02:12 PM EST

תיאור

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

תמונות/קולות

מתצפת/ת

acmicrobiology

תאריך

דצמבר 3, 2019 02:12 PM EST

תיאור

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

תמונות/קולות

מה

חופזי מנומר (Pluvialis squatarola)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 2, 2019 08:29 PM EDT

תיאור

Black-bellied Plover (non-breeding) - Pluvialis squatarola

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

נובמבר 3, 2019 02:14 PM EST

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

נובמבר 3, 2019 11:12 AM EST

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

נובמבר 3, 2019 11:07 AM EST

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 8, 2019 11:06 AM EST

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 7, 2019 08:41 PM EST

מקום

Lindo Lake (Google, OSM)

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 7, 2019 07:57 PM EST

מקום

Lindo Lake (Google, OSM)

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 3, 2019 11:23 AM EST

תמונות/קולות

מתצפת/ת

aphaywood

תאריך

נובמבר 18, 2019 11:35 AM IST

תמונות/קולות

מה

אנפה כחולה גדולה (Ardea herodias)

מתצפת/ת

jamesspitznas

תאריך

נובמבר 2, 2019 07:38 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

נובמבר 8, 2019 11:58 AM EST

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

אוגוסט 27, 2019 05:01 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יולי 26, 2019 08:33 AM EDT

תיאור

Eastern Kingbird [Flycatcher] - Tyrannus tyrannus

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יולי 26, 2019 08:30 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יולי 26, 2019 09:57 AM EDT

תיאור

Green Heron - Butorides virescens

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יולי 26, 2019 08:16 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יולי 3, 2019 05:03 AM EDT

תמונות/קולות

מה

סנונית עצים (Tachycineta bicolor)

מתצפת/ת

jamesspitznas

תאריך

אפריל 21, 2019 09:46 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

יוני 27, 2019 04:26 PM EDT

מקום

Reston, VA, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

מאי 24, 2019 09:45 AM EDT

תיאור

Eastern Bluebird (female) - Sialia sialis

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

מאי 24, 2019 09:15 AM EDT

תיאור

Eastern Bluebird (male) - Sialia sialis

תמונות/קולות

מה

שחפית ים (Sterna hirundo)

מתצפת/ת

congonaturalist

תאריך

יוני 18, 2019 12:05 PM EDT

תיאור

Catching a fish

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

מאי 24, 2019 08:27 AM EDT

תגיות

תמונות/קולות

מה

נמר אפריקאי (Panthera pardus ssp. pardus)

מתצפת/ת

evan81

תאריך

אפריל 2019

תמונות/קולות

מתצפת/ת

alyssacritters

תאריך

אפריל 2019

מקום

Florida, US (Google, OSM)

תיאור

Heard the kite smack into a tree branch and didn't realize what it was doing until it dropped this guy from above!

תמונות/קולות

מה

אנפה כחולה גדולה (Ardea herodias)

מתצפת/ת

jamesspitznas

תאריך

אפריל 21, 2019 09:01 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

אפריל 21, 2019 10:27 AM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

אפריל 21, 2019 08:13 AM EDT

תמונות/קולות

מה

סנונית עצים (Tachycineta bicolor)

מתצפת/ת

jamesspitznas

תאריך

מרץ 31, 2019 06:26 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

מרץ 31, 2019 07:01 PM EDT

תמונות/קולות

מה

אווז קנדי (Branta canadensis)

מתצפת/ת

jamesspitznas

תאריך

מרץ 31, 2019 06:46 PM EDT

תמונות/קולות

מה

צבגון אדום אוזן (Trachemys scripta)

מתצפת/ת

jamesspitznas

תאריך

אפריל 1, 2019 05:23 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

אפריל 3, 2019 05:36 PM EDT

תמונות/קולות

מתצפת/ת

carrieseltzer

תאריך

מרץ 29, 2019 05:21 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

מרץ 1, 2019 08:59 PM EST

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

פברואר 25, 2019 09:29 PM EST

תגיות

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

jamesspitznas

תאריך

פברואר 25, 2019 09:12 PM EST

תיאור

Black-crowned Night-Heron - Nycticorax nycticorax

תמונות/קולות

מה

פורפיריה צהובת רגל (Porphyrio martinica)

מתצפת/ת

tomdriscoll

תאריך

פברואר 14, 2019 10:40 AM EST

תמונות/קולות

מתצפת/ת

rhjackso

תאריך

פברואר 28, 2019 03:24 PM PST

תמונות/קולות

מתצפת/ת

josh_vandermeulen

תאריך

מאי 10, 2015 02:25 PM EDT

תמונות/קולות

מתצפת/ת

manuelbecerril

תאריך

ינואר 4, 2019

מקום

Tlalpan (Google, OSM)

תיאור

Macho.

תמונות/קולות

מתצפת/ת

uzun

תאריך

ינואר 4, 2019 09:25 AM PST

תמונות/קולות

מתצפת/ת

mattk561

תאריך

דצמבר 13, 2018 09:06 AM PST

תיאור

Bobelaine Sanctuary

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

דצמבר 1, 2018 09:31 AM EST

מקום

Reston, VA, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

jariemames

תאריך

נובמבר 27, 2018 11:01 AM EST

תמונות/קולות

מתצפת/ת

jariemames

תאריך

נובמבר 27, 2018 11:03 AM EST

תמונות/קולות

מה

אנפת לילה (Nycticorax nycticorax)

מתצפת/ת

avocat

תאריך

נובמבר 3, 2018 04:48 PM PDT

תמונות/קולות

מתצפת/ת

bob15noble

תאריך

יולי 30, 2018 01:16 PM EDT

תמונות/קולות

מתצפת/ת

jamesspitznas

תאריך

ספטמבר 3, 2018 09:33 AM EDT

תיאור

Eastern Bluebird [Thrush] - Sialia sialis

תמונות/קולות

מתצפת/ת

wayne_fidler

תאריך

אוגוסט 29, 2018 12:26 PM EDT

מקום

Caimanera, Cuba (Google, OSM)

תמונות/קולות

מתצפת/ת

kenchamberlain

תאריך

ינואר 31, 2015 05:36 AM PST

תמונות/קולות

מתצפת/ת

kenchamberlain

תאריך

ינואר 31, 2015 05:44 AM PST

תמונות/קולות

מתצפת/ת

kenchamberlain

תאריך

ינואר 31, 2015 05:32 AM PST

תמונות/קולות

מתצפת/ת

kenchamberlain

תאריך

ינואר 31, 2015 11:21 AM PST

תמונות/קולות

מתצפת/ת

kalamurphyking

תאריך

ספטמבר 29, 2015 01:51 PM CDT

תיאור

Photo 1: Mockingbirds don't eat my birdseed but they love my bird bath.
Photo 2: I was being very still but this look happened when one of my cats jumped up on the window sill to see what was out there. Check out the tiny little water drops on the tail.
Photo 3: In the middle of the bath it just sat and soaked for a minute.
Photo 4: This was taken a moment before it flew up into a tree to preen and dry off.

תמונות/קולות

מתצפת/ת

brenbarr

תאריך

יולי 19, 2018 07:59 AM MDT

תמונות/קולות

מתצפת/ת

dpdawes

תאריך

יולי 1, 2018 07:13 PM EDT