תמונות/קולות

מתצפת/ת

flygrl67

תאריך

נובמבר 2022

תיאור

Growing on dead Quercus agrifolia; I've been watching this site fruit for a few seasons, and yesterday I noticed a new fruitbody, which I collected as a voucher specimen.

תמונות/קולות

מתצפת/ת

federicocalledda

תאריך

נובמבר 20, 2022 12:00 PM CET

תמונות/קולות

מתצפת/ת

birdernaturalist

תאריך

נובמבר 12, 2006 04:31 PM CST

תמונות/קולות

מתצפת/ת

tshahan

תאריך

ספטמבר 2020

מקום

Oklahoma, US (Google, OSM)

תמונות/קולות

מתצפת/ת

richtehan

תאריך

אוקטובר 23, 2022 01:37 PM EDT

תמונות/קולות

מתצפת/ת

aperturesciencebydan

תאריך

דצמבר 12, 2021 04:53 PM EST

תיאור

Male

תמונות/קולות

מה

פקועיים (סדרה Agaricales)

מתצפת/ת

madronyut

תאריך

ינואר 12, 2019 03:06 PM PST

תמונות/קולות

מתצפת/ת

chrisotter

תאריך

ינואר 16, 2021

תיאור

Found in a burned second growth redwood grove. There was an area of several hundred square meters of the same species surrounding it.

תמונות/קולות

מתצפת/ת

mike-potts

תאריך

אוקטובר 29, 2022 07:06 AM PDT

תיאור

Tiny specimens (5mm) on the cut end of a large (5' diameter) downed fir covered in moss.

תמונות/קולות

מתצפת/ת

mhedin

תאריך

אוקטובר 30, 2022 08:20 AM PDT

תמונות/קולות

מתצפת/ת

damontighe

תאריך

ספטמבר 11, 2022 08:08 AM PDT

תמונות/קולות

מתצפת/ת

damontighe

תאריך

אוקטובר 23, 2022 05:39 PM PDT

תמונות/קולות

מתצפת/ת

norikonbu

תאריך

אוקטובר 22, 2022 02:26 PM PDT

תמונות/קולות

מתצפת/ת

julienpometta

תאריך

אוקטובר 22, 2022 02:44 PM PDT

תמונות/קולות

מתצפת/ת

julienpometta

תאריך

אוקטובר 22, 2022 03:13 PM PDT

תיאור

Hydrophobic, more tuberous formations underneath fruiting bodies about 4 inches below surface of ground.

תמונות/קולות

מתצפת/ת

dietel

תאריך

אוקטובר 12, 2022 07:30 PM PDT

תיאור

Growing on fallen Tanoak with old, dry Crepidotus on log close by

תמונות/קולות

מתצפת/ת

julienpometta

תאריך

אוקטובר 19, 2022 04:23 PM PDT

תיאור

Clay clumps of mycelium under fruiting bodies. Microscopy of mycelium.

תמונות/קולות

מתצפת/ת

luca_hickey

תאריך

אוקטובר 19, 2022 02:00 PM PDT

תיאור

On madrone log

תמונות/קולות

מתצפת/ת

underwaterpat

תאריך

ספטמבר 23, 2022 09:00 PM PDT

תמונות/קולות

מתצפת/ת

anneliesewilson

תאריך

אוקטובר 20, 2022 10:47 AM PDT

תמונות/קולות

מתצפת/ת

msoares

תאריך

אוקטובר 19, 2022 02:35 PM PDT

תיאור

Exuberant cindercap @leptonia

Fungi

תמונות/קולות

מה

פטריות (ממלכה Fungi)

מתצפת/ת

msoares

תאריך

אוקטובר 15, 2022 02:14 PM PDT

תיאור

Growing on a live grape

תמונות/קולות

מתצפת/ת

julienpometta

תאריך

אוקטובר 19, 2022 02:13 PM PDT

תיאור

Found on UCSC campus in a smallish burn zone. Seemed to be fruiting only in patches that were burned. In a mixed evergreen forest consisting of redwoods, douglas-fir, madrone, huckleberry, and the occasional oak. The base of the stipe seems like it connects to clumps of clay soil underground. The soil has sparkly minerals in it. There are small nuggets of mycelium is inside the larger clumps of clay soil. No strong flavor, dries out mouth slightly, light fungal smell. White spores that powder coat caps underneath and leave rings of white spore powder on the soil beneath the cap.

תמונות/קולות

מתצפת/ת

flygrl67

תאריך

אוקטובר 2022

תיאור

under Quercus agrifolia
video: https://photos.app.goo.gl/7itC2p3FG7pnfzxB6
observed with @lindsaybest

תמונות/קולות

מתצפת/ת

alyejidnef

תאריך

אוקטובר 15, 2022 01:58 PM PDT

תיאור

Growing out of the dudleya !

תמונות/קולות

מתצפת/ת

kimberlyjay

תאריך

אוקטובר 15, 2022 02:07 PM PDT

תמונות/קולות

מתצפת/ת

corbascus

תאריך

אוקטובר 18, 2022 09:37 AM PDT

תמונות/קולות

מתצפת/ת

craigahoover

תאריך

יוני 21, 2017 01:27 AM PDT

תיאור

Two Halgerda terramtuentis were located on coral reef wall at a depth of approximately 30 feet. Sizes were not measured. Water temperature was 74 degrees F.

תמונות/קולות

מתצפת/ת

morganyacullo

תאריך

אוקטובר 17, 2022 05:03 PM PDT

תיאור

what a wonderful creature

תמונות/קולות

מתצפת/ת

luca_hickey

תאריך

אוקטובר 14, 2022 03:46 PM PDT

תיאור

At the base of Chrysolepis chrysophylla

תמונות/קולות

מתצפת/ת

rcavazos

תאריך

אוגוסט 2, 2022 10:40 AM PDT

תמונות/קולות

מתצפת/ת

u_phantasticus

תאריך

ינואר 2020

מקום

California, US (Google, OSM)

תמונות/קולות

מתצפת/ת

silenthunter

תאריך

ינואר 26, 2022 01:24 PM PST

תמונות/קולות

מתצפת/ת

cjs041

תאריך

דצמבר 26, 2021 02:00 PM PST

תמונות/קולות

מתצפת/ת

levi5384

תאריך

ספטמבר 12, 2022 11:02 AM PDT

תיאור

Barefoot Amanita? Found just after some rain, the first rain in a couple months. Growing under a bush.

תמונות/קולות

מתצפת/ת

ewasiukb

תאריך

ספטמבר 2022

תיאור

Under Manzanita, alligator juniper, and Emery oak. Sweeet taste.

תמונות/קולות

מתצפת/ת

spencer_wimmer

תאריך

אוגוסט 27, 2022 07:50 AM MST

תמונות/קולות

מתצפת/ת

ctrubo

תאריך

אוגוסט 24, 2022 11:29 AM MST

תמונות/קולות

מתצפת/ת

marco_mazza

תאריך

ספטמבר 5, 2022 05:35 PM PDT

תמונות/קולות

מתצפת/ת

agnishino

תאריך

אוגוסט 2021

תמונות/קולות

מתצפת/ת

thehyphaemovement

תאריך

אוגוסט 19, 2022 09:35 AM PDT

תיאור

F000098

Average Spore Size:
16.85 x 8.79 µm

Spore Size Range:
(14.59 - 18.55) x (7.56 - 9.73) µm

Spores Measured: 32

The photo of hyphae is showing the clamped lamellar trama. The remaining microscopy photos that aren't of spores are of structures on the gill edge - I think cheilocystidia but am not sure. Interestingly I didn't see anything I could conclusively say was a basidium despite looking for quite some time.

תמונות/קולות

מתצפת/ת

flygrl67

תאריך

אוגוסט 2022

מקום

United States (Google, OSM)

תיאור

Developed dark spores overnight (see last image)

תמונות/קולות

מתצפת/ת

flygrl67

תאריך

אוגוסט 2022

מקום

United States (Google, OSM)

תמונות/קולות

מתצפת/ת

flygrl67

תאריך

אוגוסט 2022

תיאור

Growing among a variety of oaks (see last two images for the environment); collection was assembled from fruitbodies in 6 locations in the same general area; observed with @sigridjakob and @arborsam; taste: slightly sour like lemon

תמונות/קולות

מתצפת/ת

domthefishman

תאריך

יולי 5, 2022 06:34 PM +08

תמונות/קולות

מתצפת/ת

thehyphaemovement

תאריך

אוגוסט 19, 2022 09:41 AM PDT

תיאור

F000099

תמונות/קולות

מתצפת/ת

krizztofu

תאריך

אוגוסט 5, 2022 01:31 PM PDT

תיאור

Growing on Madrone , appears to have pores. I took a small tissue sample for sequencing .

תמונות/קולות

מתצפת/ת

dnl_biodisperso

תאריך

דצמבר 27, 2021 02:16 AM -03

תמונות/קולות

מתצפת/ת

giacomo_bruni

תאריך

דצמבר 2, 2014 05:08 PM -03

תמונות/קולות

מתצפת/ת

pulk

תאריך

נובמבר 30, 2021

תיאור



At the base of a Douglas-fir. Western redcedar also present.

Mild smell, mild taste.

Additional notes for sequences (bases on the right):

ITS: Sequenced by the Matheny Lab

Originally posted to Mushroom Observer on Jan. 17, 2022.

תגיות

תמונות/קולות

מתצפת/ת

capt1matt

תאריך

יולי 7, 2022 09:54 AM PDT

תמונות/קולות

מתצפת/ת

warren_cardimona

תאריך

יוני 12, 2022 04:28 PM PDT

תיאור

Stigmatella aurantiaca(?)

תמונות/קולות

מה

פשפשים (תת-סדרה Heteroptera)

מתצפת/ת

cynestor

תאריך

יוני 28, 2022 02:12 PM PDT

תמונות/קולות

מתצפת/ת

rahunt2

תאריך

מאי 15, 2009

מקום

Costa Rica (Google, OSM)

תמונות/קולות

מתצפת/ת

uwkwaj

תאריך

מאי 6, 2019

תמונות/קולות

מתצפת/ת

brian_r_mayes

תאריך

מאי 1, 2022 08:02 AM AEST

תמונות/קולות

מתצפת/ת

disciseda

תאריך

אוגוסט 25, 2010 11:48 AM MDT

תמונות/קולות

מתצפת/ת

kevinhintsa

תאריך

מאי 2022

מקום

פרטי

תיאור

Contra Costa County , California . Known site , exact location not shown .

תמונות/קולות

מתצפת/ת

luca_hickey

תאריך

דצמבר 17, 2019

תיאור

Interesting

תמונות/קולות

מתצפת/ת

jlippert2218

תאריך

נובמבר 1, 2020 03:00 PM PST

תיאור

On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation

תמונות/קולות

מתצפת/ת

yanivsegal

תאריך

מרץ 2022

מקום

Israel (Google, OSM)

תיאור

Calongea prieguensis

תמונות/קולות

מתצפת/ת

luca_hickey

תאריך

ספטמבר 27, 2020 10:10 AM PDT

תמונות/קולות

מתצפת/ת

jgarciapelayohsu

תאריך

דצמבר 2021

תמונות/קולות

מתצפת/ת

betweenthelyons

תאריך

מרץ 2022

מקום

California, US (Google, OSM)

תיאור

Lots in burn zone

תמונות/קולות

תאריך

מרץ 2022

מקום

Florida, US (Google, OSM)

תיאור

Additional photos and close ups of main individual.

תמונות/קולות

מתצפת/ת

corndog

תאריך

מרץ 22, 2022 08:18 PM PDT

תמונות/קולות

מתצפת/ת

morganstickrod

תאריך

מרץ 2022

תמונות/קולות

מתצפת/ת

riverahlquist

תאריך

מרץ 17, 2022 01:38 PM CDT

תמונות/קולות

מתצפת/ת

lilcar

תאריך

יוני 5, 2021 04:53 PM CEST

תמונות/קולות

מתצפת/ת

logancrees

תאריך

מרץ 10, 2022 11:09 AM CST

תמונות/קולות

מתצפת/ת

malacothrix

תאריך

ינואר 15, 2022 11:54 AM PST

תיאור

SOMA foray

Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby

תמונות/קולות

מה

חסילון גמל שלמה טווסי (Odontodactylus scyllarus)

מתצפת/ת

jennykeeping

תאריך

דצמבר 20, 2018 05:55 AM SAST

תמונות/קולות

מתצפת/ת

ym_wang_pnw

תאריך

פברואר 1, 2022 11:13 AM UTC

תמונות/קולות

מתצפת/ת

ym_wang_pnw

תאריך

פברואר 18, 2022 03:38 PM PST

תמונות/קולות

מה

פקועיים (סדרה Agaricales)

מתצפת/ת

lizziepop

תאריך

ינואר 30, 2009

תיאור

Bulbous Mushroom


Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana

תגיות

תמונות/קולות

מתצפת/ת

stucumber_

תאריך

פברואר 10, 2019 02:48 PM PST

תמונות/קולות

מתצפת/ת

biocowboy

תאריך

מרץ 4, 2022 01:47 PM PST

תמונות/קולות

מתצפת/ת

nikborrow

תאריך

ינואר 31, 2022

תמונות/קולות

מתצפת/ת

dannymi

תאריך

נובמבר 5, 2018

מקום

PSMS ID Clinic (Google, OSM)

תמונות/קולות

מתצפת/ת

claudia_jeannette

תאריך

אוקטובר 2011

תמונות/קולות

מתצפת/ת

garmonb0zia

תאריך

מרץ 21, 2019 12:27 PM PDT

תיאור

Growing on ericameria stem, strongly farinaceous odor.

תמונות/קולות

מתצפת/ת

chloe_and_trevor

תאריך

ינואר 8, 2022 06:16 PM PST

תמונות/קולות

מתצפת/ת

melsocal

תאריך

פברואר 21, 2022 10:42 AM PST

תמונות/קולות

מתצפת/ת

fungee

תאריך

יולי 2019

מקום

New York, US (Google, OSM)

תיאור

red oak, hemlock, yellow birch

תגיות

c7

תמונות/קולות

מתצפת/ת

andesgascon_alex

תאריך

אפריל 6, 2020

תמונות/קולות

מתצפת/ת

morganstickrod

תאריך

נובמבר 2020

מקום

California, US (Google, OSM)

תמונות/קולות

מתצפת/ת

danielle775

תאריך

אוגוסט 25, 2021 08:06 AM UTC

תיאור

Growing on decomposing White Birch

תמונות/קולות

מתצפת/ת

chelseamcd

תאריך

מאי 19, 2020

מקום

Castlegar (Google, OSM)

תמונות/קולות

מתצפת/ת

autumna

תאריך

נובמבר 15, 2020 01:48 PM PST

תיאור

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

תמונות/קולות

מתצפת/ת

chuckie1997

תאריך

אוקטובר 24, 2020 07:13 PM PDT

מקום

Beaverton (Google, OSM)

תמונות/קולות

מתצפת/ת

brettjackson

תאריך

פברואר 17, 2022 02:09 PM CST

תיאור

On the underside of Quercus pagoda leaf. A few alate individuals present.

White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .

תמונות/קולות

מתצפת/ת

leptonia

תאריך

מאי 29, 2020 09:15 AM PDT

תגיות

תמונות/קולות

מתצפת/ת

tmurray74

תאריך

מרץ 2014

מקום

United States (Google, OSM)

תיאור

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

תמונות/קולות

מתצפת/ת

dwborland

תאריך

יולי 28, 2013 06:12 PM EDT

תיאור

Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida

rather uncommon

syn. Clitocybe rappiana

תמונות/קולות

מתצפת/ת

silversea_starsong

תאריך

מרץ 5, 2017 09:21 AM PST

תמונות/קולות

מתצפת/ת

kschnei

תאריך

אפריל 18, 2019 11:44 AM PDT

תיאור

Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.

תמונות/קולות

מתצפת/ת

rtshaw80

תאריך

מרץ 27, 2015 10:56 AM CDT

תמונות/קולות

מתצפת/ת

rtshaw80

תאריך

מרץ 24, 2015 12:33 PM CDT

תמונות/קולות

מתצפת/ת

rtshaw80

תאריך

מרץ 24, 2015 08:06 AM CDT

תמונות/קולות

מתצפת/ת

dgreenberger

תאריך

פברואר 6, 2022 04:51 PM PST