Crest. Relatively close to the road, gigantic crest on a relatively short plant.
Growing on a sweetgum leaf. Found under a lot of leaf litter.
Green, irregular growths on the underside of decaying log in mixed wood forest.
Indian Creek that connects to Elk River / Richland Creek.
I first collected this on Chinese privet (Ligustrum sinense) in Knoxville, Tennessee in 2016 (
https://www.inaturalist.org/observations/7004049) having no idea even what phylum to place it in, guessing (incorrectly) that it could be a Septobasidium, or a corticioid/crust, or something else entirely.
Jacob Kalichman (@pulk) and I made a second collection of the same fungus on the same substrate two years later along a trail in Great Smoky Mountains National Park (https://www.inaturalist.org/observations/112054261). This time we took it to the microscope, where a scalp section revealed a palisade of erect, parallel, clavate structures that turned a beautiful deep royal blue in the presence of KOH, with yellowish-brown, subglobose to broadly ellipsoid propagules forming along the upper portions of the structures (see micrographs in first iNat link).
Dr. Brandon Matheny was kind enough to sequence that second collection for us. At the time, the nearest BLAST match (83% per. ident.) to that sequence was an accession labelled Hypoxylon fuscum, followed by several lower percentage matches in the Hypoxylaceae. Our fungus was therefore probably an anamorph belonging to that family, making structures we'd observed conidiophores with their corresponding conidia. When brought to the attention of Dr. Roo Vandegrift (@werdnus), he proposed calling this sp. Virgariella; an anamorph known to occur across a wide range of xylariaceous taxa, including the Hypoxylon fuscum group. A more precise, teleomorphic name might follow with a more solid match in GenBank or, ideally, by collecting and studying the teleomorph, should it ever be found.
Over the next four years, what started as a minor curiosity of mine from a horticultural trail in downtown Knoxville, became a widely recognized fungal feature all throughout the southern Appalachian region, resulting in 44 observations from 13 individual observers (at the time of writing). Unfortunately, every single one of them was missing a teleomorph.
Last December, at the Gulf States Mycological Society Winter Foray, more anamorphic collections of this unidentified hypoxyloid came in. One of the club's members vowed to keep an eye out for any teleomorphic-looking growths on the abundant Chinese privet that occurs near his home and work (as a prolifically invasive tree sp., it's not difficult to find).
On March 1st, 2024, said member and their partner came over for dinner. With them they brought a few branches of Chinese privet with a "surprise" on them for me to examine. Lo and behold, they had found the elusive teleomorph, shown here.*
KOH extractable pigments reddish-orange/ochraceous, latently becoming somewhat vinaceous.
Spore micrographs show remnants of perispore dehiscence (in 10% KOH), a nearly spore-length and relatively straight germ slit, and two guttules in many/most of the spores. Dimensions are as follows:
(10.9) 11.6 - 13.7 (14.2) × (5.1) 5.2 - 5.8 (6.3) µm
Q = (2) 2.1 - 2.4 (2.8) ; N = 20
Me = 12.5 × 5.6 µm ; Qe = 2.3
.* = Macro shots are placeholders, better images forthcoming following the resolution of some particularly painful camera issues.
Something causing discoloration and curling in sweetgum leaves.
Additional notes for sequences (bases on the right):
—
Additional sequences:
ITS: https://mycomap.com/...
AGAGGGTAAAGGCGAACGCTTTGACTAGTTTATATTATTACAAACCCTTTTATTGTTATGTGAATGTAATGCTCCTTGTGGGCGATAATGTTAATACAACTTTCAACAACGGATCTCTAGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCGTGTTAATCTCAAATCACTTGTCTTATGTTTGCTTCTTGATTGAAGTAGGCTGACTTGCGATTTGGACTTGGAGGTTTTATGCTGGCCCGGGCGACGACTTTGTTGTTA
—
Originally posted to Mushroom Observer on Dec. 24, 2017.
Every single photo is blurry, ugh. This one was odd, when I scraped some off to take a sample, it exposed bright orange in a few places. I was unable to tell if it was the medulla?
It looks like this coyote has had a rough life. Lots of facial scars, especially around the left eye but seems to be doing well now.
Interested to know what this fuzzy stuff is?
Can also be seen in pictures in this observation:
https://www.inaturalist.org/observations/197197534
On planted Corylus americana. The plant had several normal catkins but then these odd ones. Is it some sort of gall?
Originally posted to MycoMap.com on August 2, 2017 by MycoMap.com user: Stephen Russell at https://mycomap.com/6577.
growing alongside M. candidus. Could they be rhizomorphs?
ID tentative, but this is my best guess. Found in rosette formation on Privet ( Ligustrum sinense )
Last picture is the lichen that was on the other side of the twig
Growing in the cracks of bark on hackberry tree. Bark is very moist, so I was able to pull back layers which revealed the larger pieces seen in the photo. The tree was located along an alleyway which is shady most of the day, but does get some sun. It rained the night before and the temperature was in the 40’s.
The orange bit. A bryoparasite I think. I believe it's on orthotrichum, but not positive.
Spaulted wood created by mycelium partitioning in the log or host tree
Growing on a leaf. Nearby trees: Quercus, Pinus, Fagus, Ulmus
under Pinus taeda, Pinus virginiana. Growing on and around a rotting pine branch.
This is very very soft, like too wet bread dough. Growing on the underside of a dead log of unknown type in mixed wood forest.
will split if the black and deep marron are different, to me it looked like old & new of same