תמונות/קולות

מתצפת/ת

jmrobertia

תאריך

מאי 11, 2021 01:33 PM AKDT

מקום

Cohoe, AK, USA (Google, OSM)

תיאור

Found this one within 3 feet of where I found what I believe is this same species last summer. it can be viewed here https://www.inaturalist.org/observations/53692487

תמונות/קולות

Square

מתצפת/ת

drbowser

תאריך

אפריל 12, 2021 11:07 AM EDT

תמונות/קולות

מתצפת/ת

alandqz

תאריך

מרץ 20, 2021 01:25 PM PDT

תיאור

Scales present on scapus and pedicellus of antenna, but not on flagellum, making it Petrobiinae. Compound eyes wider than long (deep), ocelli without obvious constriction, and environment (around upper limit of intertidal zone) indicate the species Neomachilis halophila.

תמונות/קולות

Square

מתצפת/ת

drbowser

תאריך

מרץ 25, 2021 12:52 PM EDT

מקום

Ocala, FL, US (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

yargonoth

תאריך

יולי 3, 2020 01:43 PM AKDT

מקום

Kasilof, AK, US (Google, OSM)

תמונות/קולות

מתצפת/ת

gwark

תאריך

אפריל 25, 2017 05:06 PM AKDT

מקום

Sitka, AK (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

drbowser

תאריך

פברואר 12, 2021 11:54 AM EST

תמונות/קולות

מתצפת/ת

akarcher

תאריך

אוגוסט 21, 2018 05:41 PM AKDT

תמונות/קולות

מתצפת/ת

drbowser

תאריך

ינואר 23, 2021 10:37 AM EST

תמונות/קולות

Square

מתצפת/ת

robertdevelice

תאריך

ינואר 13, 2021 12:19 PM AKST
Fungi

תמונות/קולות

Square

מה

פטריות ממלכה Fungi

מתצפת/ת

stotherah

תאריך

אוגוסט 17, 2020 05:54 PM AKDT

מקום

Seward, AK, US (Google, OSM)

תמונות/קולות

מתצפת/ת

drbowser

תאריך

ינואר 11, 2021 10:59 AM EST

תמונות/קולות

מתצפת/ת

drbowser

תאריך

ינואר 11, 2021 08:32 AM EST

תמונות/קולות

מתצפת/ת

gwark

תאריך

דצמבר 31, 2020 02:22 PM AKST

תיאור

found by @sitkaconnor

תגיות

תמונות/קולות

מתצפת/ת

jmrobertia

תאריך

יולי 22, 2019 12:06 PM AKDT

תיאור

Juvenile male (not entirely sure of the ID) found hunting on some alder limbs at the parking lot of the Bear Mt Trail.

תמונות/קולות

מה

רקבן מפוספס Eristalinus taeniops

מתצפת/ת

muir

תאריך

נובמבר 9, 2016 10:36 AM GMT

תמונות/קולות

מתצפת/ת

gwark

תאריך

אוגוסט 22, 2020 10:54 AM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

gwark

תאריך

אוגוסט 22, 2020 10:59 AM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

gwark

תאריך

יולי 1, 2020 01:14 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

gwark

תאריך

ספטמבר 12, 2020 09:17 AM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

donnahandley89

תאריך

אוגוסט 20, 2015 12:00 PM AKDT

תמונות/קולות

Square

מתצפת/ת

mckittre

תאריך

יולי 3, 2020 10:24 AM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יולי 8, 2020 03:59 PM AKDT

תמונות/קולות

מתצפת/ת

gwark

תאריך

יולי 3, 2020 12:08 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תיאור

Photos include a couple with UV light (one mixed, one only UV), the one in hand shows cap after KOH applied (no significant color change, just mainly got darker).

תמונות/קולות

מתצפת/ת

gwark

תאריך

יולי 2, 2020 03:01 PM AKDT

תמונות/קולות

Square

מתצפת/ת

colcan927

תאריך

יוני 25, 2020 11:46 AM AKDT

תמונות/קולות

מתצפת/ת

nealkelso

תאריך

יוני 22, 2020 08:43 AM CDT

תיאור

With mite.

תמונות/קולות

Square

מה

חיפושיות מים -שחיניתיים משפחה Dytiscidae

מתצפת/ת

gwark

תאריך

מאי 4, 2020 03:46 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

awenninger

תאריך

יוני 21, 2018 09:48 AM AKDT

תיאור

on wild rose, Rosa acicularis

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אוקטובר 6, 2013 12:59 PM AKDT

תיאור

leaf mines probably a fly

תמונות/קולות

מתצפת/ת

jmrobertia

תאריך

מאי 28, 2020 02:14 PM AKDT

תיאור

Seen in old burn of Hidden Creek Trail with at least a half dozen other diurnal moths and butterflies.

תמונות/קולות

Square

מתצפת/ת

jmrobertia

תאריך

מאי 28, 2020 02:18 PM AKDT

תיאור

Seen in old burn of Hidden Creek Trail.

תמונות/קולות

מתצפת/ת

gwark

תאריך

אפריל 14, 2020 08:02 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

colcan927

תאריך

מאי 28, 2020 02:03 PM AKDT

תמונות/קולות

מתצפת/ת

muir

תאריך

אפריל 30, 2020 02:56 PM AKDT

תיאור

Observed in tidal grassland mud. New grass growth not apparent yet.

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אפריל 25, 2020 01:43 PM AKDT

תמונות/קולות

Square

מתצפת/ת

michiganhummingbirdguy

תאריך

יוני 7, 2004

תיאור

Hudsonian Whiteface
(Leucorrhinia hudsonica)
Swanson Lakes, AK
Photo by Allen Chartier
Date Taken : 2004/06/07

תמונות/קולות

מה

קסיס סוג Xysticus

מתצפת/ת

gwark

תאריך

אוגוסט 25, 2019 02:45 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אוגוסט 4, 2019 11:49 PM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אוגוסט 4, 2019 11:49 PM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

ינואר 8, 2016 02:29 PM AKST

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

gwark

תאריך

יולי 25, 2015 08:37 PM AKDT

תיאור

Larva from salmonberry leaf miner. collected https://www.inaturalist.org/calendar/gwark/2015/7/21

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יולי 25, 2015 08:30 PM AKDT

תיאור

Pupa from geum leaf miner collected: https://www.inaturalist.org/calendar/gwark/2015/7/21

תמונות/קולות

Square

מתצפת/ת

robertweeden

תאריך

יולי 20, 2019 04:09 PM AKDT

תיאור

on yarrow flowers in open high-grass meadow.

id credit to V. Belov at BugGuide

תמונות/קולות

מתצפת/ת

awenninger

תאריך

אוקטובר 24, 2019 09:54 AM AKDT

תיאור

From Sitka spruce

תמונות/קולות

Square

מתצפת/ת

meagangibson

תאריך

אוגוסט 25, 2019 05:00 PM AKDT

תמונות/קולות

Square

מתצפת/ת

akarcher

תאריך

ספטמבר 7, 2019 05:47 PM AKDT

תיאור

First time I have seen wild roses blooming in the fall! Lots of hips on the same plant

תמונות/קולות

מתצפת/ת

dssikes

תאריך

אוגוסט 16, 2019 11:03 PM AKDT

תיאור

4-5 white, flat, worms, 3-5" long. 2 were collected. moist ground after rain, near cooling pond. Observation, photos & collection by Cynthia Pflughoeft.

תמונות/קולות

Square

מתצפת/ת

awenninger

תאריך

יוני 20, 2019 04:43 PM AKDT

תיאור

On. P. Balsamifera

תמונות/קולות

Square

מתצפת/ת

awenninger

תאריך

מאי 29, 2019 03:43 PM AKDT

מקום

Homer, AK, USA (Google, OSM)

תיאור

On nettle

תמונות/קולות

Square

מתצפת/ת

josiahesimmons

תאריך

מאי 23, 2019 03:10 PM AKDT

תמונות/קולות

Square

מתצפת/ת

stotherah

תאריך

מאי 17, 2019 07:49 PM AKDT

תמונות/קולות

מתצפת/ת

brucebennett

תאריך

יוני 30, 2018 06:38 AM PDT

תיאור

Collected in willow leaf litter. Sent off for identification

תמונות/קולות

מתצפת/ת

gwark

תאריך

אוגוסט 23, 2014 12:23 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תיאור

Geum macrophyllum

תמונות/קולות

מתצפת/ת

gwark

תאריך

אוגוסט 23, 2014 12:29 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תיאור

In Rubus spectabilis

תמונות/קולות

מתצפת/ת

gwark

תאריך

אוגוסט 11, 2018 12:52 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

muir

תאריך

נובמבר 17, 2018 11:44 AM CET

מקום

Brazzaville (Google, OSM)

תיאור

For sale in an open air market.

תמונות/קולות

Square

מתצפת/ת

kmohatt

תאריך

אוגוסט 23, 2010 11:15 PM AKDT

תמונות/קולות

Square

מתצפת/ת

kmohatt

תאריך

אוגוסט 9, 2018 07:09 PM AKDT

תמונות/קולות

Square

מתצפת/ת

kmohatt

תאריך

אוגוסט 25, 2016 02:36 PM AKDT

תיאור

ACCCTTTGTAGTCCTGGAACACCTCTCGAGGCAACTCGGTTTGAGGATTGCCGCTGCTGNTAAGCCGGCTTTCCTTGCGTTCCCGGTCTATGTCTTTATATACCCCATGAATGTAACTGAATGTCTTTAATGGGCCTTAGTGCCTTTAAATCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTTTTATTAGCTTGGTCAGGCTTGGATGTGGGGGTTGCGGGCTTCTCAGAAGTCGGCTCTCCTTAAATGCATTAGCGGAACCTTTGTTGACCAGCTCTGGTGTGATAATTATCTACGCCATTGCGAAGCAGCTTTAATAATGGGGTTCAGCTTCTAACCGTCCCCTTCACGGGACAACTCTCTGACATTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

תמונות/קולות

מתצפת/ת

gwark

תאריך

ספטמבר 11, 2017 03:57 PM AKDT

תיאור

On Leymus mollis

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אוקטובר 15, 2018 09:17 AM AKDT

תמונות/קולות

מתצפת/ת

gwark

תאריך

ספטמבר 29, 2018 03:11 PM AKDT

תמונות/קולות

מתצפת/ת

domwatts

תאריך

יולי 26, 2018

תמונות/קולות

Square

מתצפת/ת

awenninger

תאריך

אוגוסט 2, 2018 11:13 AM AKDT

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 14, 2017

מקום

Rainbow Lake (Google, OSM)

תיאור

Scale bar = 10 µm

N. hitchcockii has characteristic triundulate valve margins and pointed apices.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

Valves are biundulate. The axial area is wide; sometimes nearly as wide as the central constriction. Differentiated from the similar Staurosira contruens var. binodis based on striae characteristics and valve size.

תמונות/קולות

Square

מתצפת/ת

awenninger

תאריך

יולי 16, 2018 01:46 PM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יולי 13, 2018 05:32 AM AKDT

תמונות/קולות

מתצפת/ת

gwark

תאריך

יולי 9, 2018 05:13 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תיאור

parasitic larval stage infecting a jellyfish - collected by visiting researcher @natalie53

תמונות/קולות

Square

מתצפת/ת

awenninger

תאריך

יוני 24, 2018 12:07 PM AKDT

תמונות/קולות

מתצפת/ת

muir

תאריך

יוני 22, 2018 09:41 PM AKDT

תמונות/קולות

מתצפת/ת

awenninger

תאריך

מאי 25, 2018 09:05 AM AKDT

תיאור

Reared from Dendroctonus rufipennis host. Emerged 31 May 2018. Keyed to Coeloides rufovariegatus, and sent one to LifeScanner. LifeScanner returns identification to Coeloides genus. When I enter the barcode into the BOLD ID engine, it also matches to "Coeloides" without a species-level match. Coeloides rufovariegatus is the only Coeloides species listed in the Arctos specimen database for Alaska.

DNA: BOLD-2R4: COI-5P: TTTTATATTTTTTTTTTGGTATGTGATCTGGAATATTAGGTTTATCAATAAGTTTAATTATTCGTATAGAATTAAGTATACCTGGTAGAATATTAGGAAATGATCAAATTTATAATGGAATAGTTACTACTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATATTAGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGTGCTCCGGATATAGCATTTCCTCGAATAAATAATATGAGATTTTGATTATTAATTCCTTCAATTATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGTACTGGTTGAACAATTTATCCTCCATTATCTTCATCTTTAGGACATAGGGGATTATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTATGGGTTCAATTAATTTTATTTCAACAATTTTAAATATACATTTATTTAAATTGGAATTAGATCAATTAACTTTATTGATTTGATCAGTTTTTATTACTACAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTGAATACAACTTTTTTTGATTNTCAGGGGGGGG

תמונות/קולות

Square

מתצפת/ת

jmrobertia

תאריך

יוני 3, 2018 05:11 PM AKDT

תיאור

Was literally standing in the Keen-Eye Trail near the KNWR Visitors Center.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

E. adnata has valves that are dorsiventral and taper toward rounded rostrate ends. The dorsal margin is convex, while the ventral margin is concave. This species is distinguished from E. turgida based on its finer striae and its larger number of striae per costae.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

Valves are biundulate, differentiating them from the nominate variety S. construens. Valves are small with rostrate to subcapitate ends. Differentiated from the similar Pseudostaurosira robusta by striae characteristics and valve size.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

Valves are small, cruciform, and have rostrate to subcapitate ends. The central margin is inflated and curved. S. construens is differentiated from Pseudostaurosira pseudoconstruens based on its more narrow central sternum, and from Staurosirella leptostauron based on its narrower striae.

תמונות/קולות

מתצפת/ת

swiseeagle

תאריך

מאי 14, 2006

תיאור

Caught by shrimp trawler.

תמונות/קולות

מתצפת/ת

muir

תאריך

מאי 26, 2018 04:26 PM AKDT

מקום

Kincaid Park (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 14, 2017

מקום

Rainbow Lake (Google, OSM)

תיאור

Scale bar = 10 µm

The shape of S. grunowii valves is dinstinctive, with concave margins, but valves that otherwise reflect the characteristics of S. linearis. This species is often cited in the literature as S. linearis var. constricta.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 14, 2017

מקום

Rainbow Lake (Google, OSM)

תיאור

Scale bar = 10 µm

N. iridis ranges has a large size range and valve shapes can differ. Specimens in this sample closely resemble certain individuals documented by Foged (1981) and Krammer and Lange-Bertalot (1997).

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

E. turgida valves are dorsiventral and taper toward rostrate ends, and are relatively large for the genus. E. turgida has coarser striae than E. adnata, as well as fewer striae per costae.

תמונות/קולות

Square

מתצפת/ת

ebroadman

תאריך

יוני 19, 2017

תיאור

Scale bar = 10 µm

Valves are concentrically undulate and large, and are convex or concave. Aereolae are arranged in radiating striae, separated by hyaline costae. S. reimeri is similar, but is smaller, with a lower areolae density.

תמונות/קולות

מה

נתרנאים סדרה Archaeognatha

מתצפת/ת

treegrow

תאריך

ספטמבר 3, 2017 02:16 PM EDT

תיאור

Rock Creek Park, Washington, DC, USA.

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אוגוסט 17, 2007 06:24 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

אפריל 17, 2007 12:39 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

cedric_lee

תאריך

דצמבר 27, 2017 03:14 PM PST

מקום

California, US (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

hydaticus

תאריך

דצמבר 17, 2017 10:29 PM CST

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יוני 28, 2006 01:57 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)

תמונות/קולות

מתצפת/ת

treegrow

תאריך

יולי 30, 2017 03:38 PM EDT

תיאור

Rock Creek Park, Washington, DC, USA.

תמונות/קולות

מתצפת/ת

aaronbaldwin

תאריך

יולי 14, 2010 11:34 AM AKDT

מקום

Homer, AK, USA (Google, OSM)

תיאור

Only Alaskan crangonid lacking dorsal carapace spines. This specimen is infected by the bopyrid isopod Argeia pugettensis.

תמונות/קולות

מתצפת/ת

nakarb

תאריך

יוני 10, 2017 10:07 PM MSK

תמונות/קולות

Square

מתצפת/ת

dssikes

תאריך

יולי 11, 2017 09:24 AM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יולי 5, 2017 05:48 PM AKDT

מקום

Sitka, AK (Google, OSM)

תיאור

Leaf mine in cow parsnip (Heracleum maximum)

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יוני 28, 2017 12:57 PM AKDT

תמונות/קולות

מתצפת/ת

gwark

תאריך

יוני 19, 2017 11:35 AM AKDT

מקום

Sitka, AK (Google, OSM)

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

יוני 14, 2017 01:38 PM AKDT

תמונות/קולות

Square

מתצפת/ת

bnwech

תאריך

יוני 15, 2016

תמונות/קולות

מתצפת/ת

gwark

תאריך

מאי 15, 2017 01:57 PM AKDT

תמונות/קולות

Square

מתצפת/ת

gwark

תאריך

מאי 3, 2003 04:37 PM AKDT

מקום

Sitka, AK, USA (Google, OSM)